agree SO HARD
Rs333
is a snp is mentioned by dbSNP rs333 PheGenI rs333 nextbio rs333 hapmap rs333 1000 genomes rs333 hgdp rs333 ensembl rs333 gopubmed rs333 geneview rs333 scholar rs333 rs333 pharmgkb rs333 gwascentral rs333 openSNP rs333 23andMe rs333 23andMe all rs333 SNP Nexus SNPshot rs333 SNPdbe rs333 MSV3d rs333
Gene CCR5
Chromosome 3
Orientation plus
Position 46414947
Reference GRCh37 37.1/131
Max Magnitude 4
Geno Mag Summary (-;-) 4 very resistant to HIV (-;GTCAGTATCAATTCTGGAAGAATTTCCAGACA) 2 resistant to HIV (GTCAGTATCAATTCTGGAAGAATTTCCAGACA;GTCAGTATCAATTCTGGAAGAATTTCCAGACA) 0 common form The chemokine receptor gene CCR5 plays an important role in many immune-related processes. Delta 32 rs333, designating the CCR5-delta32 deletion of 32 nucleotides from within the gene, is perhaps the most famous allele of CCR5. 23andMe tests for this by the name I3003626.
Individuals carrying one copy of the delta 32 allele are somewhat resistant to infection by HIV, the virus that causes AIDS, and individuals with 2 copies (delta 32 homozygotes, ~1% of Caucasians) are almost completely immune to infection by HIV. [PMID 8898752] The delta 32 allele may have been selected for in European populations because it confers resistance to plague (Black Death) or smallpox. [1]
On Fri, Jun 22, 2012 at 9:10 PM, Jason Bobe <jasonbobe@gmail.com> wrote:Any other favorite superpowers w/ associated genetic variants?
Candidate genes for sports doping:ACEACTN3HIFmyostatin/follistatinPPAR-deltaVEGFYou received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diybio@googlegroups.com.
To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
For more options, visit https://groups.google.com/groups/opt_out.
"And if ye cannot be saints of knowledge, then be at least its warriors."
-- Friedrich Nietzsche
--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diybio@googlegroups.com.
To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
For more options, visit https://groups.google.com/groups/opt_out.







0 comments:
Post a Comment