Science

Dear Partner

 

Hope you are doing great!!

 

Please go through the requirement and let me know if you have any consultant for the same position.

 

Oracle DBA

Mountain View, CA

12+ Months

Phone Hire

 

•             Provides DBA support for production and development databases.Works closely with management, peers, DBAs, architects, and network administrators/engineers to provide direction in identifying and resolving database-related issues. As an Operations DBA, would review all production changes, monitor production databases, perform capacity planning, and ensure optimal performance. Also perform deployments and installations through a release process.

•             Minimum 10+ years of hands-on experience with high volume, highly available enterprise database (ORACLE) systems with MS/BS in Computer Science or equivalent.

•             Extensive experience in Oracle 9i / 10g/11g

•             Performance Tuning: explain plan/showplan and sql/odbc traces; pl/sql and sql tuning; benchmarking; entity denormalization; index best practices and partitioning.

•             Performance Tuning with TB+ data volume.

•             Proven ability to develop, design and implement database with high availability, operations supportability and scalability

•             Able to Perform database server administration, maintenance including patches, DB tuning tasks, policies for DEV and QA databases

•             Self learner with ability to constantly uptake new technologies, experiment with them and implement them for the benefit of the development team

•             Knowledge of implementing disaster recovery strategy, knowing tools like Oracle Data Guard

•             Hands-on experience with Oracle RAC (Real Application Cluster) environments.

•             Excellent written and verbal communication skills.

•             Knowledge of the payroll industry, including payroll application experience, highly desirable.

•             Excellent time management skills

 

 

Thanks and Regards,

Arpit Arora | Technical Recruiter

Technology Resource Group Inc. 
3736 Hillsdale Court Santa Clara, CA 95051

Office:408-709-1760 Ext : 961, Cell: 909-859-1312

Gtalk: Arpittechwire | Fax: 408-884-2409

Arpit@tresourceinc.com | www.tresourceinc.com

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Note: Candidate must have experience in

 

·         Here we are looking for Operations Database Administrator (DBA) someone who can help in Production and Development of databases; Design, Develop, Implement databases

·         Have experience with "PAYROLL" Application

·         Monitor Production Database

·         Performance Tuning of high volume database

·         Capacity Planning

·         10+ Year experience dealing with high volume database, enterprise database (ORACLE)

·         Exp with Oracle 9i/10g/11g

·         Oracle RAC (Real Application  Cluster)

·         Oracle Data Guard

·         SQL/ ODBC Traces

·         SQL & PL/SQL Tuning

·         MS/BS in Computer Science

 

Thanks and Regards,

Mamta Bisht

3736 Hills-Dale Court,

Santa Clara, CA 95051

408-426-2031

408-709-1760 Extn: 938

 

 

The local Amsterdam television channel 5 made a report on our lab. It is part of a show in which they explore a certain street, this time it was ours.

Dear Partner

Hope you are doing great!!

Please go through the requirement and let me know if you have any consultant for the same position.

 

Java Lead

Boca Raton,FL

6+ Months

Phone Hire

 

We have a Lead Java role in Boca FL. 6+ month contract looking for a lead java developer

with WebSphere server application, spring, Hibernate

 

 

Thanks and Regards,

Arpit Arora | Technical Recruiter

Technology Resource Group Inc. 
3736 Hillsdale Court Santa Clara, CA 95051

Office:408-709-1760 Ext : 961, Cell: 909-859-1312

Gtalk: Arpittechwire | Fax: 408-884-2409

Arpit@tresourceinc.com | www.tresourceinc.com

 

 

 

Perhaps you could approach it the other way around, use sound to manipulate growth.

Do Genomikon kit for sure.  Synbio engineer new bacteria in a short afternoon.  Make them glow.    The best journalism mentions references explicitly so please make sure to do that. 

Also read the diybio faq, http://openwetware.org/wiki/DIYbio/FAQ
 


"Produces radiation" um, what.  FFS..   Note you will never get bubbling because the yields on anything a bacteria makes will be so low, that if one tiny visible bubble forms per hour, you'd be lucky.

Curiously.. the most publicly fascinating and most photographed and most filmed "experiment" of a local & highly celebrated diybio lab here in the biotech center of the world (right down the street from Life Technologies) was made when I brought in an aquarium pump bubbler and stuck the air-producing end into a big beaker of water.  Then I added food coloring to make the water green and put it near a tube rack.  The journalists loved it.  WOW!   A bubbling experiment in a biotech lab!   Filmed for the evening news!   (I'm not kidding.)  I didn't have the heart to tell them it was just water with a cheap $12 Walmart aquarium pump --- then likely they would not have cared because they just wanted sexy, emotionally-jarring images for the masses.  They had little interest in the real bacto-culture experiment growing just a table away, or the custom electronics with column filtration setup next to that.  Not photogenic enough for them I suppose.    I believe one of the biggest limitations of DIY biology is primarily the lack of education of... certain people.. people like..  hmm... let's see.. who might I be thinking of..  guess..


So regarding the radio listening audience.  Any audio will only come from the equipment you use.  Probably motor sounds from the vortexer and centrifuge and microwave oven.   Maybe the fluorescent tubes in the UV illuminator will buzz softly.   If they have a fridge, then of course that fan will make a nice hum.   Now you could make a custom electronics hack, like connect a light-sensitive resistor or photodiode to an opamp and get it to produce a sine wave depending on how bright the bacteria is glowing *but no one does that in science, that is just a gimmick for impressing poseurs* --- however you could build the circuit in an afternoon using my data acquisition article in BioCoder Issue #6 (I mention this not as a plug, only what comes to mind as a basic reference circuit which a biohacker group should be able to build up in a few hours).

You could also try using a spikerbox, with one of the spikerbox example experiments.  That makes a loud click or squeal from it's speaker when the neuron fires in a poor little insect which you've penetrated by a needle probe.  You might like that part (journalists love to vivisect don't they?).  The spikerbox is actually used in science.   A group can build the spikerbox from a simple kit in an afternoon.   Supply your own crickets.  https://backyardbrains.com/products/spikerbox


## Jonathan Cline
## jcline@ieee.org
## Mobile: +1-805-617-0223
########################


On Wednesday, April 29, 2015 at 5:16:57 AM UTC-7, Sam Francis wrote:

Hi all,

The other night I attended the biohacking lab at the London hackspace and a few of you recommended I put my requests to the collective hivemind on here.

I'm a producer for a BBC Radio 4 Specials in the UK and we're doing a documentary on synthetic biology for our Futureproofing series (http://www.bbc.co.uk/programmes/b04hyy1p). To help give a good idea the ease and the limitations of doing synthetic biology with DIY lab equipment we want to get our two reporters to begin the show with an experiment, which we will then use as a strand to tie the whole story together.

As such could any of you suggest an experiment that shows off the potential of the technology that two journalists un-trained in biology and largely ignorant could do with minimum supervision?

We have a few requirements:

1. the ideal would be something that works on radio
   
2. we must be able to start and complete the experiment in two weeks
3. the experiment can be carried out using only basic kit or the equipment at the London hackspace (https://wiki.london.hackspace.org.uk/view/Group:Biohacking )
4. it must be interesting enough to capture the imagination of the outside world

Any ideas, musings or suggestions would be greatly appreciated.

Best wishes,

Sam

Hey there,

Thanks for even more informative insight. I read the paper, and I knew about this ahead of time because of my professor who told me about it. It took a few days for my post to be approved and posted on here, so unfortunately I was unable to update it.


I'm starting to think I should just wait and take a few more bio classes before I start meddling with this stuff. I understand most of what I am doing, but I dont understand HOW I do it.

The 35S promoter is here https://www.addgene.org/12588/ It was recommended to me by my biology lab professor because it will express the gene, at the expense of the plants lifespan.

That gameplan was more of me just trying to get my unorganized thoughts down on paper, I was planning on making a total step by step to the dot manual.

As for the plasmid sequencing, I was hoping I could find an already shrunken Ti Plasmid somewhere, and cut the gene into the plasmid myself.

Anyways, here are my last few questions:

How would I cut between the lux genes without restriction sites being there?

How can I stick two dna strands cut with different enzymes together?

As you can tell, I'm just fumbling around, but I have learned an amazing amount by just hypothesizing about theoretical glowing plants.




On Wednesday, April 29, 2015 at 6:38:16 AM UTC-7, Koeng wrote:

The main issue is is that the lux operon *will not* be expressed in plants under these conditions. Eukaryotes do not use polycistronic mRNA molecules (there are exceptions I know but nearly all genes). To see what would be required for proper lux operon expression, check out the paper I linked. They describe using 4 different promoter sets to express the lux proteins, which is probably the amount you would require. I'd recommend trying this with bacteria first to see how finicky biology is first; you'll be able to get a wonderful experience without putting too much out. 

Now onto some other issues. You do not have to cut out genes to PCR them, you can PCR them directly off plasmids. Next, your primers anneal to the inside of luxC and the outside of the EM7 promoter, ampilfying 241 base pairs. Also, what PCR mastermix will you be using? This matters a lot. Whether it be Q5, phusion, taq, Accura, or pfu, this is something you'd need to plan. Taq, for example, is extremely error prone and adds A to the end of amplified molecules (useful for TA cloning though). The lux cassette also would not have an EcoRI site after the entire cassette, so it would not clone properly. I don't see much info about your promoter choice either: the sequence of the plasmid isn't even defined at addgene. Does it have a polyA tail? What's its copy number in E coli? Where does the 35S promoter come from? What sequencing company will you use for your plasmid?

All-in-all, before making a game plan on how to do it, make a very detailed plan on exactly why you do each of the steps and identify what is required for expression. For example, check exactly why putting the entire lux operon from bacteria into a eukaryote doesn't work. (paper is linked in last message)

-Koeng

On Wednesday, April 29, 2015 at 5:16:08 AM UTC-7, Bijan wrote:

Thanks for the informative reply.

I've started to piece together a basic game plan, but I am actually going to work with more simple stuff first to get the hang of what I'm doing.

Here is the basic plan I made last night

Methods:

1. First, the luxABCDE gene will be isolated from the plasmid pGEN-luxCDABE via restriction enzyme PmeI + SacI, which will cut at the beginning of the luxA gene, and end after the terminator at luxE.

2. The isolated lux genes will be amplified with PCR, the required primers (CATATGAAGCTTGGTACCGGGATC)5' and (CTTTCGGGAAAGATTTCAACCTGG)3' will be obtained and added to the master solution

3. After amplification, the DNA will then be inserted into another plasmid (pBabe puro H-Ras 12V (35S)). The 35S mutation was chosen as it is a very strong promoter, and the gene is more likely to be expressed. To insert, the DNA will be cut using the restriction enzyme EcoRI which will make a cut at the end of the promoter. The lux gene will then be inserted.

4. The promoter plasmid will be transformed into e. Coli and multiplied.  It will then be extracted.

5. Agrobacterium tumefaciens will be used as the insertion vector for the lux gene into the plant. The plasmid will be integrated with the Agrobacterium at the tsite using electroporation and the bacteria will be cultured on petridishes containing Puromycin, as it is the marker for our plasmid.

6. Using the protocol outlined here: http://www.plantpath.wisc.edu /fac/afb/protocols arobitosis will be grown and infected by the agrobacterium.

https://www.addgene.org/12588/

https://www.addgene.org/44918/

Enter code here...

On Monday, April 27, 2015 at 2:52:22 PM UTC-7, Koeng wrote:

Large biosynthesis operons are usually very difficult to clone. Largely the reason is is that the fundamental methods of gene expression are different in each organism, making it pretty hard to explore their biology without high-throughput library methods to get favorable or native expression rates of each said protein. If you check out the glowing plant kickstarter, you'll notice that they haven't even completed their glowing plant. 

A few questions to consider:

How does gene expression differ between eukaryotes and prokaryotes?

What are the location differences between eukaryotes and prokaryotes and why do those matter?

What is an IRES?

What's the difference between a kozak sequence and a RBS sequence?

How do you transform plants?

Why does the lux cassette work well in E coli and not yeast?

However, after all, it is biology, so with a little more planning it technically *is* possible. Check out this paper for more details- http://femsyr.oxfordjournals.org/content/4/3/305.long . It's fairly good and goes over some issues they've had with yeast, a much easier organism to work with. 

Glowing plants have been criticized quite a bit in this community, mostly because so far (without chloroplast integration, another topic) it doesn't seem to work very well. Anyway, you could check out some of the kits from the-odin, http://www.the-odin.com/bioluminescent-e-coli-kit/ , which from my experience (with the plasmid) seem to work very well. 

Good luck!

-Koeng

On Monday, April 27, 2015 at 6:13:19 AM UTC-7, Bijan wrote:

First off, I've only taken freshman biology, I have no idea what I am doing at a professional level.

Alright, I think I have an idea for making glowing plants. I was thinking I could use this -> http://en.wikipedia.org/wiki/Agrobacterium_tumefaciens#Beneficial_uses With a 35S promoter (Which I can illegally get with some GMO food if I can find the right primers). Ill take the promotor and the Lux cassete from somewhere and insert it into the agro t-area which will inject it into the plant DNA.

What I don't know is

1.) How to get the 35S promoter primers
2.) How to stick the promotor on the luxABCD gene.
3.) How to isolate the t-area and integrate it into the phage cell.

 I just put this together myself. But it seems possible right?

Dear Partner

 

Hope you are doing great!!

 

Please go through the requirement and let me know if you have any consultant for the same position.

 

5: Java Developer

Location: Parsippany, NJ

Duration: 6 months

Interview: Face to face

 

NOTE: Submit only Valid Visa holders – Need visa copy for review

Recent managerial references will be verified – Need References with Submission

Thorough background check will be run

 

The candidate must be proficient at using J2EE/Java technologies and understand all activities in the application development department.  This individual will demonstrate strong analytical and problem solving skills while maintaining strong written and verbal communication.

Roles and Responsibilities:

• Advanced knowledge and demonstration of Java/J2EE.
• Possess a strong understanding of internal architecture, design patterns and programming for Modular and Object Oriented programming.
• Understand all activities within an application development department.
• Strong leadership ability when managing cross functional team atmospheres but also have the ability to work and act in a non-supervised environment.
• Demonstrate a deep understanding on multiple SDLC methods.
• Understand the marketplace's latest trends and mobile technologies.

Job Experience:

• At least 6 years of application development experience in a Java environment.
• Past experience in multi-location or offshore development teams.
• Demonstrate large scale enterprise project experience.
• At least 2 years of high level project management and design.
• At least 2 years of Unified Modeling Language (UML) experience.
• At least 2 years of Web Service integration experience. 
• At least 2 years of performance in module level analysis and design.

Preferred Qualifications:

• J2EE (JSP, Servlets, EJBs, JSTL)
• XML Technologies & Web Services
• Web 2.0
• Spring MVC
• Hibernate
• HTML, Javascript, jQuery CSS
• Experience with Oracle Data base, Oracle Coherence Data grid, Business Rules Management Systems, Oracle SOA Suite will be a plus. 

 

Thanks and Regards,

Arpit Arora | Technical Recruiter

Technology Resource Group Inc. 
3736 Hillsdale Court Santa Clara, CA 95051

Office:408-709-1760 Ext : 961, Cell: 909-859-1312

Gtalk: Arpittechwire | Fax: 408-884-2409

Arpit@tresourceinc.com | www.tresourceinc.com