Re: [DIYbio] Re: Plant Kozaks from a Cloning Perspective

My promoter actually exists in plant(s) by nature, at least in one sequenced plant. When BLASTed it has 0 gaps and 100% identity with its natural counterpart. That's why I selected it. It just has too many A's the closer it gets to the ATG.

Here's the minimal form of it >> AAGACTTTCTCTCTCTACACATACACCTACACCAGAAAAAAGAAAAAAATA derived from Madagascar periwinkle

Depending on what species you look at in the softberry promoter database you will get a good amount of uninterrupted poly-A binders/unzip in the promoter region.
for extreme example look at this
> PLPR0232 ..AC:X57171 ..OS:Dianthus caryophyllus ..GENE:CARSR12 ..PROD:CARSR12 ..[ -200: +51] ..CDS:+145 ..TSS:201 (+1) |Taxon: Dicot |Promoter: TATA-less
aatctaaaacaaaaaaagaaaacttttaagtgtcagattatatttaatattttcaaaatgactatagcaaattaaaaaaagaaaaaaaaaaaaaaaaaaaaacggggggccccacaaaaacatgtataaattcagcttcacaccctccaaattctctgcaacatccttcattctttccattaatatttttaatattttttCCTCTCTTAAAATAAGGGAGAAAATAAATAGATTAATCCACCAATTTTAGC

On Saturday, November 21, 2015 at 3:08:05 AM UTC-5, Cathal (Phone) wrote:
Has anyone tried that consensus to see if it actually works? IIRC the consensus RBS for E.coli actually doesn't work, theory is that it's too strong and won't release the sigma-factor!

On 21 November 2015 05:37:11 GMT+00:00, Yuriy <yuriy...@gmail.com> wrote:
Yeah they won't synthesize it either. Too many A's, they say. I had too much of it in enhancer, Kozak and terminator  

Also they don't like to synthesize anything with a restriction site like BsaI. I guess they use it in their synthesis process or end processing.

I thought I optimized all there is to optimize all 4 kb and then this. Next step, working with the company and its advisers. 

On Friday, February 21, 2014 at 1:50:19 PM UTC-5, Sebastian wrote:
Here's another question for you guys and gals:

The most optimal consensus sequence for EUKARYOTIC expression in plants is:

AAA AAA AAA ACA

upstream to the ATG and then a G at the +1 position. Making primers amplify this into a CDS seems to be a horrid idea. In theory, the ton of adenines will make for one difficult pcr attempt.

What would you suggest the best method for cloning this particular sequence into a CDS?

One method may be two shorter (adenine wise) primers that overlap and amplify the cds in two steps. That would leave twice the chance for error not to mention increase cost. The other method is synthesis but lets be honest, synthetic biology is great if you have money. I, like most DIY Biologists, have grossly insufficient funds for synthesizing every damn gene with said Kozak or every promoter with a terminal kozak motif.

Biobricks are great but scars and the burden of making nonBB parts into BB is heavy.

Any ideas are welcome. I know I asked this before in a more broader context but this time there is a more specific issue. Thanks in advance!


Sebastian S. Cocioba
CEO & Founder
New York Botanics, LLC
Plant Biotech R&D


--
Sent from my Android device with K-9 Mail. Please excuse my brevity.

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/a11557cf-6483-495a-b90e-962fea0c44b2%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

0 comments:

Post a Comment