Behind the scenes they use phosphoramatide-(sp?)-based synthesis of
100-200bp oligonucleotides which are then assembled by PCR or ligation
into the full sequence.
Beyond the use of high-quality inhouse oligosynthesis, their methods
differ little from your methods might, except that:
A) They specialise in just this job and problem (Maybe you do too?)
B) Once you order, it's *their problem*! :)
On 02/02/12 01:02, Nathan McCorkle wrote:
> Gene synth works by uploading you sequence and choosing a
> vector/restriction sites that you want flanking the sequence... you
> pay... and then get a tube with a plasmid containing your sequence in
> the mail, all ready for transformation and mini/midi/maxi prep
>
> On Wed, Feb 1, 2012 at 7:25 PM, Jeswin <phillyj101@gmail.com> wrote:
>> On Wed, Feb 1, 2012 at 6:42 PM, Nathan McCorkle <nmz787@gmail.com> wrote:
>>> How many hours of cloning do you think you did? at 800bp * $0.30/bp ==
>>> $240... $240 / 16 hours = $15/hr... so at a low pay rate that's two
>>> days of work. Did you mess around more than 2 days before ligating the
>>> final repeat sequence into a vector?
>>>
>>
>> Well, as I was inexperienced (been at least 2 years since I had done
>> cloning last) I think I made a few mistakes in the process. Otherwise
>> this would have been faster. When I had asked the question about how
>> to do this, it was just me that didn't know what was going on. The
>> boss already had the primers to do the deletion. I was trying to
>> figure it out myself.
>>
>> And don't forget that we had the insert sequenced to double check that
>> it went in correct orientation and position. So another day and $22
>>
>> How much DNA do the synthesis companies send back? We probably
>> extracted around 1 ug/uL (have to double check but it is high).
>>
>> How do the companies synthesize? You send in the sequence what you
>> want, they put it thru their machine and send back some DNA?
>>
>> I am guessing that our company was given this job because the customer
>> had some particular reason not to do this via commercial synthesis.
>> Cost was probably only one issue. I don't know much more.
>>
>>
>>> On Wed, Feb 1, 2012 at 6:24 PM, Jeswin <phillyj101@gmail.com> wrote:
>>>> Hey guys, the boss was able to get the insert as required and we just
>>>> did the maxi-prep and DNA purification today. Anyway, you all wondered
>>>> why it wasn't easier to get this synthesized instead of deleting
>>>> through PCR. I asked him and he said that the whole insert in which
>>>> the repeat occurs is 800bp long. This is too expensive to synthesize.
>>>>
>>>> Thanks for your help in this
>>>>
>>>> On Mon, Jan 23, 2012 at 8:51 PM, Jeswin <phillyj101@gmail.com> wrote:
>>>>> This sucks, I posted the primer in the above post. The repeat sequence is
>>>>>
>>>>> gggccaggtggtgcagggccaggtggtgcagggccaggtggtgcagggccaggtggtgcagggcccggtggtgcaggtccaggtggtgcaggtccaggtggtgcaggtccaggtggtgct
>>>>>
>>>>> I hate all this copy/paste. All the g,c,t,a make my eyes cross
>>>>> On Mon, Jan 23, 2012 at 8:45 PM, Jeswin <phillyj101@gmail.com> wrote:
>>>>>> On Mon, Jan 23, 2012 at 4:19 PM, Nathan McCorkle <nmz787@gmail.com> wrote:
>>>>>>
>>>>>>> I meant what is the sequence that repeats... you gave two sequence
>>>>>>> snippets earlier, but they didn't seem to repeat 8 times in the .docx
>>>>>>> file you posted... not sure if you make some typos or I'm a victim of
>>>>>>> CTRL-F screwing up at line breaks (I was gonna throw the sequence into
>>>>>>> python/bioPython and do some crunching)
>>>>>>>
>>>>>>
>>>>>> My bad, I only posted the first line, forgot the rest:
>>>>>>
>>>>>> ggacgagctgtacaaggggccag
>>>>>> gtggtgcagggcccggtggtgca
>>>>>> ggtccaggtggtgcaggtccaggt
>>>>>> ggtgcaggtccaggtggtgctatg
>>>>>> gtgagcaagggcgaggagct
>>>>>>
>>>>>> The first few ends in "gca" but the rest end in "gct"
>>>>
>>>> --
>>>> You received this message because you are subscribed to the Google Groups "DIYbio" group.
>>>> To post to this group, send email to diybio@googlegroups.com.
>>>> To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
>>>> For more options, visit this group at http://groups.google.com/group/diybio?hl=en.
>>>>
>>>
>>>
>>>
>>> --
>>> Nathan McCorkle
>>> Rochester Institute of Technology
>>> College of Science, Biotechnology/Bioinformatics
>>>
>>> --
>>> You received this message because you are subscribed to the Google Groups "DIYbio" group.
>>> To post to this group, send email to diybio@googlegroups.com.
>>> To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
>>> For more options, visit this group at http://groups.google.com/group/diybio?hl=en.
>>>
>>
>> --
>> You received this message because you are subscribed to the Google Groups "DIYbio" group.
>> To post to this group, send email to diybio@googlegroups.com.
>> To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
>> For more options, visit this group at http://groups.google.com/group/diybio?hl=en.
>>
>
>
>
--
www.indiebiotech.com
twitter.com/onetruecathal
joindiaspora.com/u/cathalgarvey
PGP Public Key: http://bit.ly/CathalGKey
--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diybio@googlegroups.com.
To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
For more options, visit this group at http://groups.google.com/group/diybio?hl=en.
0 comments:
Post a Comment