Gene synth works by uploading you sequence and choosing a
vector/restriction sites that you want flanking the sequence... you
pay... and then get a tube with a plasmid containing your sequence in
the mail, all ready for transformation and mini/midi/maxi prep
On Wed, Feb 1, 2012 at 7:25 PM, Jeswin <phillyj101@gmail.com> wrote:
> On Wed, Feb 1, 2012 at 6:42 PM, Nathan McCorkle <nmz787@gmail.com> wrote:
>> How many hours of cloning do you think you did? at 800bp * $0.30/bp ==
>> $240... $240 / 16 hours = $15/hr... so at a low pay rate that's two
>> days of work. Did you mess around more than 2 days before ligating the
>> final repeat sequence into a vector?
>>
>
> Well, as I was inexperienced (been at least 2 years since I had done
> cloning last) I think I made a few mistakes in the process. Otherwise
> this would have been faster. When I had asked the question about how
> to do this, it was just me that didn't know what was going on. The
> boss already had the primers to do the deletion. I was trying to
> figure it out myself.
>
> And don't forget that we had the insert sequenced to double check that
> it went in correct orientation and position. So another day and $22
>
> How much DNA do the synthesis companies send back? We probably
> extracted around 1 ug/uL (have to double check but it is high).
>
> How do the companies synthesize? You send in the sequence what you
> want, they put it thru their machine and send back some DNA?
>
> I am guessing that our company was given this job because the customer
> had some particular reason not to do this via commercial synthesis.
> Cost was probably only one issue. I don't know much more.
>
>
>> On Wed, Feb 1, 2012 at 6:24 PM, Jeswin <phillyj101@gmail.com> wrote:
>>> Hey guys, the boss was able to get the insert as required and we just
>>> did the maxi-prep and DNA purification today. Anyway, you all wondered
>>> why it wasn't easier to get this synthesized instead of deleting
>>> through PCR. I asked him and he said that the whole insert in which
>>> the repeat occurs is 800bp long. This is too expensive to synthesize.
>>>
>>> Thanks for your help in this
>>>
>>> On Mon, Jan 23, 2012 at 8:51 PM, Jeswin <phillyj101@gmail.com> wrote:
>>>> This sucks, I posted the primer in the above post. The repeat sequence is
>>>>
>>>> gggccaggtggtgcagggccaggtggtgcagggccaggtggtgcagggccaggtggtgcagggcccggtggtgcaggtccaggtggtgcaggtccaggtggtgcaggtccaggtggtgct
>>>>
>>>> I hate all this copy/paste. All the g,c,t,a make my eyes cross
>>>> On Mon, Jan 23, 2012 at 8:45 PM, Jeswin <phillyj101@gmail.com> wrote:
>>>>> On Mon, Jan 23, 2012 at 4:19 PM, Nathan McCorkle <nmz787@gmail.com> wrote:
>>>>>
>>>>>> I meant what is the sequence that repeats... you gave two sequence
>>>>>> snippets earlier, but they didn't seem to repeat 8 times in the .docx
>>>>>> file you posted... not sure if you make some typos or I'm a victim of
>>>>>> CTRL-F screwing up at line breaks (I was gonna throw the sequence into
>>>>>> python/bioPython and do some crunching)
>>>>>>
>>>>>
>>>>> My bad, I only posted the first line, forgot the rest:
>>>>>
>>>>> ggacgagctgtacaaggggccag
>>>>> gtggtgcagggcccggtggtgca
>>>>> ggtccaggtggtgcaggtccaggt
>>>>> ggtgcaggtccaggtggtgctatg
>>>>> gtgagcaagggcgaggagct
>>>>>
>>>>> The first few ends in "gca" but the rest end in "gct"
>>>
>>> --
>>> You received this message because you are subscribed to the Google Groups "DIYbio" group.
>>> To post to this group, send email to diybio@googlegroups.com.
>>> To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
>>> For more options, visit this group at http://groups.google.com/group/diybio?hl=en.
>>>
>>
>>
>>
>> --
>> Nathan McCorkle
>> Rochester Institute of Technology
>> College of Science, Biotechnology/Bioinformatics
>>
>> --
>> You received this message because you are subscribed to the Google Groups "DIYbio" group.
>> To post to this group, send email to diybio@googlegroups.com.
>> To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
>> For more options, visit this group at http://groups.google.com/group/diybio?hl=en.
>>
>
> --
> You received this message because you are subscribed to the Google Groups "DIYbio" group.
> To post to this group, send email to diybio@googlegroups.com.
> To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
> For more options, visit this group at http://groups.google.com/group/diybio?hl=en.
>
--
Nathan McCorkle
Rochester Institute of Technology
College of Science, Biotechnology/Bioinformatics
--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diybio@googlegroups.com.
To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
For more options, visit this group at http://groups.google.com/group/diybio?hl=en.
0 comments:
Post a Comment