[DIYbio] Re: Curious about creating glowing plants

Thanks for the informative reply.

I've started to piece together a basic game plan, but I am actually going to work with more simple stuff first to get the hang of what I'm doing.

Here is the basic plan I made last night


Methods:

  1. First, the luxABCDE gene will be isolated from the plasmid pGEN-luxCDABE via restriction enzyme PmeI + SacI, which will cut at the beginning of the luxA gene, and end after the terminator at luxE.

  2. The isolated lux genes will be amplified with PCR, the required primers (CATATGAAGCTTGGTACCGGGATC)5' and (CTTTCGGGAAAGATTTCAACCTGG)3' will be obtained and added to the master solution

  3. After amplification, the DNA will then be inserted into another plasmid (pBabe puro H-Ras 12V (35S)). The 35S mutation was chosen as it is a very strong promoter, and the gene is more likely to be expressed. To insert, the DNA will be cut using the restriction enzyme EcoRI which will make a cut at the end of the promoter. The lux gene will then be inserted.

  4. The promoter plasmid will be transformed into e. Coli and multiplied.  It will then be extracted.

  5. Agrobacterium tumefaciens will be used as the insertion vector for the lux gene into the plant. The plasmid will be integrated with the Agrobacterium at the tsite using electroporation and the bacteria will be cultured on petridishes containing Puromycin, as it is the marker for our plasmid.

  6. Using the protocol outlined here: http://www.plantpath.wisc.edu /fac/afb/protocols arobitosis will be grown and infected by the agrobacterium.


https://www.addgene.org/12588/

https://www.addgene.org/44918/



Enter code here...



On Monday, April 27, 2015 at 2:52:22 PM UTC-7, Koeng wrote:
Large biosynthesis operons are usually very difficult to clone. Largely the reason is is that the fundamental methods of gene expression are different in each organism, making it pretty hard to explore their biology without high-throughput library methods to get favorable or native expression rates of each said protein. If you check out the glowing plant kickstarter, you'll notice that they haven't even completed their glowing plant. 

A few questions to consider:
How does gene expression differ between eukaryotes and prokaryotes?
What are the location differences between eukaryotes and prokaryotes and why do those matter?
What is an IRES?
What's the difference between a kozak sequence and a RBS sequence?
How do you transform plants?
Why does the lux cassette work well in E coli and not yeast?

However, after all, it is biology, so with a little more planning it technically *is* possible. Check out this paper for more details- http://femsyr.oxfordjournals.org/content/4/3/305.long . It's fairly good and goes over some issues they've had with yeast, a much easier organism to work with. 

Glowing plants have been criticized quite a bit in this community, mostly because so far (without chloroplast integration, another topic) it doesn't seem to work very well. Anyway, you could check out some of the kits from the-odin, http://www.the-odin.com/bioluminescent-e-coli-kit/ , which from my experience (with the plasmid) seem to work very well. 

Good luck!
-Koeng

On Monday, April 27, 2015 at 6:13:19 AM UTC-7, Bijan wrote:
First off, I've only taken freshman biology, I have no idea what I am doing at a professional level.

Alright, I think I have an idea for making glowing plants. I was thinking I could use this -> http://en.wikipedia.org/wiki/Agrobacterium_tumefaciens#Beneficial_uses With a 35S promoter (Which I can illegally get with some GMO food if I can find the right primers). Ill take the promotor and the Lux cassete from somewhere and insert it into the agro t-area which will inject it into the plant DNA.

What I don't know is

1.) How to get the 35S promoter primers
2.) How to stick the promotor on the luxABCD gene.
3.) How to isolate the t-area and integrate it into the phage cell.

 I just put this together myself. But it seems possible right?

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/b09fddba-f1bb-453f-ac43-9d2c66568a17%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

0 comments:

Post a Comment