[DIYbio] Re: Multiplexed crispr genome editing

hi Koeng, 

Do you have any articles explaining the mentioned spacers between ribozymes? 

thanks

Den lørdag den 21. november 2015 kl. 07.41.41 UTC-8 skrev Koeng:

Yes, multiplexed spacers work. The bigger reason was to get a good RNA on the 5' end which would fold stably so the sgRNA wouldn't degrade. Then there was also the idea of how you could just plop that onto one another and you get a nicely trimmed RNA transcript. The ribozyme only works on it's 5' end

Original transcript

HDV-sgRNA_1-HDV-sgRNA_2-HDV-sgRNA_3-HDV

Processed transcript

HDV-sgRNA_1

HDV-sgRNA_2

HDV-sgRNA_3

From personal observation, it seems like it's easier to just clone them separately then goldengate them together (separate promoters and stuff). If you want to multiplex it, you'll probably just synthesize that construct^ (poor synthesis company)

-Koeng

On Friday, November 20, 2015 at 4:21:51 PM UTC-8, flight505 wrote:

@ Koeng sounds very interesting can you elaborate a bit? do you mean you trim the RNA transcript on both 5´ and 3´ ends with HDV? how as trans-acting ? and multiplexed HDV-RNA-HDV-spacer-HDV-RNA-HDV ?

Best regerds,
 
Den fredag den 20. november 2015 kl. 23.10.47 UTC+1 skrev Koeng:

This works in yeast, except we use HDV instead of hammerhead. Same idea. I haven't tried it myself, however. 

On Thursday, May 21, 2015 at 12:09:43 PM UTC-7, Mega [Andreas Stuermer] wrote:

Hi everyone,

Just came across something awesome I wanted to share.
Hammerhead ribozymes were actually successfully tried to produce multiple crispr-guide RNAs (the problem with normal mRNAs is that they are exported from the nucleus into the cytosol, but the crispr/cas9 enzyme and the DNA are in the nucleus).

Here's one paper
"Self‐processing of ribozyme‐flanked RNAs into guide RNAs in vitro and in vivo for  CRISPR‐mediated genome editing", from which I take the graphic.

Here one example how it was done:

Promoter (CMV)
tagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctggtttatgaaccgtcagatcc

UTR/RE
gagctc

homolgy site
cgacta

5' Hammerhead Ribozyme (cuts at it's 3' end)
ctgatgagtccgtgaggacgaaacgagtaagctcgtc

targeting gene sequence
tagtcgcgtgtagcgaagca

gRNA scaffold
gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc

whatever (important spacer?)
tttt

3' HDV ribozyme (cuts at the 5' of the ribozyme)
ggccggcatggtcccagcctcctcgctggcgccggctgggcaacatgcttcggcatggcgaatgggac


UTR (from cloning)
cccgggatgctagctaa

polyA
gcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccctagggggaggctaactgaaacacggaaggagacaataccggaaggaacccgcgctatgacggcaataaaaagacagaataaaacgcacggtgttgggtcgtttgttcataaacgcggggttcggtcccagggctggcactctgtcgataccccaccgagacgccattggggccaatacgcccgcgtttcttccttttccccaccccaccccccaagttcgggtgaaggcccagggctcgcagccaacgtcggggcggcaggccctgccatagcctcag


It will be probably a pain for synthesis companies to synthesize, but can save you a lot of (sub)cloning pain and costs are probably similar to getting PCR reagents and primers and stuff. If PCR doesn't even cost more.

You can thus add multiple gRNAs in one big RNA, from one promoter. Like

Promoter--(HH)-gRNA1-(HDV) --spacer--(HH)-gRNA1-(HDV) --spacer--(HH)-gRNA1-(HDV) --spacer--(HH)-gRNA1-(HDV) --spacer-- polyA

Good spacers would probably be like this
ATACTATCAATACTTATCCATCATA
ATTACTTAACCATAATATCTTAACCAT

High in AT - so no interference with ribozymes. Some Cs in it,synthesis companies have local GC content lower limits