Re: [DIYbio] Re: deletion in short tandem repeat section with PCR

How many hours of cloning do you think you did? at 800bp * $0.30/bp ==
$240... $240 / 16 hours = $15/hr... so at a low pay rate that's two
days of work. Did you mess around more than 2 days before ligating the
final repeat sequence into a vector?

On Wed, Feb 1, 2012 at 6:24 PM, Jeswin <phillyj101@gmail.com> wrote:
> Hey guys, the boss was able to get the insert as required and we just
> did the maxi-prep and DNA purification today. Anyway, you all wondered
> why it wasn't easier to get this synthesized instead of deleting
> through PCR. I asked him and he said that the whole insert in which
> the repeat occurs is 800bp long. This is too expensive to synthesize.
>
> Thanks for your help in this
>
> On Mon, Jan 23, 2012 at 8:51 PM, Jeswin <phillyj101@gmail.com> wrote:
>> This sucks, I posted the primer in the above post. The repeat sequence is
>>
>> gggccaggtggtgcagggccaggtggtgcagggccaggtggtgcagggccaggtggtgcagggcccggtggtgcaggtccaggtggtgcaggtccaggtggtgcaggtccaggtggtgct
>>
>> I hate all this copy/paste. All the g,c,t,a make my eyes cross
>> On Mon, Jan 23, 2012 at 8:45 PM, Jeswin <phillyj101@gmail.com> wrote:
>>> On Mon, Jan 23, 2012 at 4:19 PM, Nathan McCorkle <nmz787@gmail.com> wrote:
>>>
>>>> I meant what is the sequence that repeats... you gave two sequence
>>>> snippets earlier, but they didn't seem to repeat 8 times in the .docx
>>>> file you posted... not sure if you make some typos or I'm a victim of
>>>> CTRL-F screwing up at line breaks (I was gonna throw the sequence into
>>>> python/bioPython and do some crunching)
>>>>
>>>
>>> My bad, I only posted the first line, forgot the rest:
>>>
>>> ggacgagctgtacaaggggccag
>>> gtggtgcagggcccggtggtgca
>>> ggtccaggtggtgcaggtccaggt
>>> ggtgcaggtccaggtggtgctatg
>>> gtgagcaagggcgaggagct
>>>
>>> The first few ends in "gca" but the rest end in "gct"
>
> --
> You received this message because you are subscribed to the Google Groups "DIYbio" group.
> To post to this group, send email to diybio@googlegroups.com.
> To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
> For more options, visit this group at http://groups.google.com/group/diybio?hl=en.
>

--
Nathan McCorkle
Rochester Institute of Technology
College of Science, Biotechnology/Bioinformatics

--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diybio@googlegroups.com.
To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
For more options, visit this group at http://groups.google.com/group/diybio?hl=en.