[DIYbio] Re: deletion in short tandem repeat section with PCR

Hey guys, the boss was able to get the insert as required and we just
did the maxi-prep and DNA purification today. Anyway, you all wondered
why it wasn't easier to get this synthesized instead of deleting
through PCR. I asked him and he said that the whole insert in which
the repeat occurs is 800bp long. This is too expensive to synthesize.

Thanks for your help in this

On Mon, Jan 23, 2012 at 8:51 PM, Jeswin <phillyj101@gmail.com> wrote:
> This sucks, I posted the primer in the above post. The repeat sequence is
>
> gggccaggtggtgcagggccaggtggtgcagggccaggtggtgcagggccaggtggtgcagggcccggtggtgcaggtccaggtggtgcaggtccaggtggtgcaggtccaggtggtgct
>
> I hate all this copy/paste. All the g,c,t,a make my eyes cross
> On Mon, Jan 23, 2012 at 8:45 PM, Jeswin <phillyj101@gmail.com> wrote:
>> On Mon, Jan 23, 2012 at 4:19 PM, Nathan McCorkle <nmz787@gmail.com> wrote:
>>
>>> I meant what is the sequence that repeats... you gave two sequence
>>> snippets earlier, but they didn't seem to repeat 8 times in the .docx
>>> file you posted... not sure if you make some typos or I'm a victim of
>>> CTRL-F screwing up at line breaks (I was gonna throw the sequence into
>>> python/bioPython and do some crunching)
>>>
>>
>> My bad, I only posted the first line, forgot the rest:
>>
>> ggacgagctgtacaaggggccag
>> gtggtgcagggcccggtggtgca
>> ggtccaggtggtgcaggtccaggt
>> ggtgcaggtccaggtggtgctatg
>> gtgagcaagggcgaggagct
>>
>> The first few ends in "gca" but the rest end in "gct"

--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diybio@googlegroups.com.
To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
For more options, visit this group at http://groups.google.com/group/diybio?hl=en.