Re: [DIYbio] PCR trouble

You don't say what your PCR conditions were. This is a long fragment, about 6400 bp, and will require a long extension time. The primers should amplify, but if you are planning on cutting with NdeI and XhoI following PCR, then you need to extend the primers with at least 3-4 bp of junk sequence that can be cut off by the restriction enzyme. Enzymes don't like to act well at the very end of dsDNA linear fragments. For the PCR to be successful, you'll need extension times of at least 6 minutes/cycle for normal enzymes, and at least 3 minutes/cycle even with a fast enzyme such as Phusion or Q5.

You should also be aware that there is an NdeI site and an XhoI site in the middle of the luxA CDS, which means you won't be able to clone with those enzymes without additional work.

> On Mar 1, 2016, at 6:29 PM, David Ishee <midgardkennels@gmail.com> wrote:
>
> I'm trying to amplify the LuxC-LuxG (or LuxC-LuxE) section of pVIB (pJE202).
>
> This is the forward primer
> CATATG ATGAATAAATGTATTCCAATGA I added the Ndel sequence to the 5' end
>
> This is the reverse primer
> CTCGAG TTATACGTATGCAAAAGCATCGG I added the Xhol sequence to the 5' end
>
> I also tried a different primer made to bind LuxE but I don't have its sequence with me I can get it when I get home.
>
> I'm consistently getting some small product when I run it on a gel with both primer combinations. On the gel it's smaller than 1kb and very bright. I've done a lot of variations with time, temp concentration, template purity etc. I've made fresh working stock (though my original dilution make still be contaminated if that's the issue) I plan to run a PCR of each primer alone and in combination with no template and see if I still get that same product.
>
> Since I don't have a sequence for the plasmid I'm using I'm using the V. Fischeri genomic sequence from gene bank for the Lux gene sequence. The one submitted by Thomas Knight.
>
> Does anyone see any mistakes in my primer design or elsewhere?
>
> --
> -- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---
> You received this message because you are subscribed to the Google Groups "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
> To post to this group, send email to diybio@googlegroups.com.
> Visit this group at https://groups.google.com/group/diybio.
> To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/d220c0e8-cf94-4775-999b-5fb3c8b9c167%40googlegroups.com.
> For more options, visit https://groups.google.com/d/optout.

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at https://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/E7D49A3C-19B2-4CFE-88EF-722D5A224066%40mit.edu.
For more options, visit https://groups.google.com/d/optout.