Hehe, funny thing about that. I had synthesized the gene for expressing XbaI (yes the restrictive enzyme, I wanna start producing it in my lab) and could order 1 other 500 bps with the
I actually got the Hok Sok synthesized xD with primers that insert it RIGHT after ampicillin resistance in pUC19 (using gibson assembly), since that region with the origin is commonly used... such as in pMAL.
If you want some of the plasmid once I create it just email me!
-Koeng
On Friday, April 26, 2013 11:08:43 AM UTC-7, Dakota wrote:
-- On Friday, April 26, 2013 11:08:43 AM UTC-7, Dakota wrote:
Yeah I went to order the hok sok last night but I only had $40 in my
account because I just payed a student loan. Twas a sad day. Got
payed today so I'll take a better look at all the sequences and see if
one would be useful enough to warrant getting it done. I don't want
to just get one and have no intended use for it because I can see it
just sitting around and never getting a home in a plasmid.
On Fri, Apr 26, 2013 at 11:49 AM, Mega <masters...@gmail.com> wrote:
> Interesting genes...
>
>
> TCTAGAAATTAACACTCACTAAAGGGAGACGAAGGACACGAAATGGGTAGCATTAACCTG CGTATTGACGATGAACTTAAAGCGCGTTCT TACGCCGCGCTTGAAAAAATGGGTGTAACT CCTTCTGAAGCGCTTCGTCTCATGCTCGAG TATATCGCTGACAATGAACGCTTGCCGTTC AAACAGACACTCCTGAGTGATGAAGATGCT GAACTTGTGGAGATAGTGAAAGAACGGCTT CGTAATCCTAAGCCAGTACGTGTGACGCTG GATGAACTCTGAAGACCGATAATGGCGTAT TTTCTGGATTTTGACGAGCGGGCACTAAAG GAATGGCGAAAGCTGGGCTCGACGGTACGT GAACAGTTGAAAAAGAAGCTGGTTGAAGTA CTTGAGTCACCCCGGATTGAAGCAAACAAG CTCCGTGGTATGCCTGATTGTTACAAGATT AAGCTCCGGTCTTCAGGCTATCGCCTTGTA TACCAGGTTATAGACGAGAAAGTTGTCGTT TTCGTGATTTCTGTTGGGAAAAGAGAACGC TCGGAAGTATATAGCGAGGCGGTCAAACGC ATTCTCTGAGGATCC
>
> XbaI - T3 Promoter - RBS - RelB - RBS RelE - BamHI
>
>
> Shelfish Gene sequence - build them into your plasmid and it 'll never get
> lost ;)
>
>
>
>
>
>
>
>
>
> On Thursday, April 25, 2013 10:58:16 PM UTC+2, Koeng wrote:
>>
>>
>> http://www.idtdna.com/pages/landing/dna-day-2013?utm_ source=IDT+Customers&utm_ campaign=3f82c0faab-DNA_Day_ gBlocks_Special4_22_2013&utm_ medium=email
>>
>> Only today! IT IS ONLY 50 DOLLARS FOR 500 BASE PAIRS!!!! That is 10 cents
>> a base pair! This is 5 cents less then the BEST normal deal! (gene art 1000
>> base pairs).
>>
>> Also I do not want to advertise, but just wanted to share a great deal :)
>>
>> -Koeng
>
> --
> -- You received this message because you are subscribed to the Google Groups
> DIYbio group. To post to this group, send email to diy...@googlegroups.com.
> To unsubscribe from this group, send email to
> diybio+un...@googlegroups.com . For more options, visit this group at
> https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---
> You received this message because you are subscribed to the Google Groups
> "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send an
> email to diybio+un...@googlegroups.com .
> To post to this group, send email to diy...@googlegroups.com.
> Visit this group at http://groups.google.com/group/diybio?hl=en .
> To view this discussion on the web visit
> https://groups.google.com/d/msg/diybio/-/UJBIJupSzPcJ .
>
> For more options, visit https://groups.google.com/groups/opt_out .
>
>
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio?hl=en.
To view this discussion on the web visit https://groups.google.com/d/msg/diybio/-/Xgx3gnPiG_sJ.
For more options, visit https://groups.google.com/groups/opt_out.
0 comments:
Post a Comment