[DIYbio] Will this sequence work as promotor?

Sequence: ATTGTGAGCGGATAACAAAAACTTGACTAAAGATTCCTTTAGTAGATAATTGTGAGCGGATAACAATTC

It is based on p22 Salmonella phage promotor with replacement of OR1 and OR3 repressor binding sites by lactose operon repressor binding sites from Escherichia coli. How probable is what this construction will work?

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/31160580-6d1c-4c04-8a1e-46b69d32e245%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

0 comments:

Post a Comment