[DIYbio] Re: DNA design questions

I don't think Eukaryotes use RBSs...

http://en.wikipedia.org/wiki/Five_prime_cap

On Saturday, August 17, 2013 6:01:31 AM UTC-7, Mega [Andreas Sturm] wrote:
Hi all,

I am designing primers to get a kanamycin resistance gene.

My question is, the kanamycin gene (nptII)  is out of pGreenII for plants. I want it to work in E.Coli. Will the this eukaryotic RBS also work in E. Coli?

TGACGTTCCATAAATTCCCCTCGGTATCCAATTAGAGTCTCATATTCACTCTCAACTCGATCGAGGCATGATTGAACAA

As I need a BamHI site anyway, I could also mutagenize it into this...

TGACGTTCCATAAATTCCCCTCGGTATCCAATTAGAGTCTCATATTCACTCTCAACagGATCcAGGCATGATTGAACAA

The agga-motive rather looks like prokaryotic beings will accept it?


Or just leave it as it was?

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/be12715e-5407-4bdd-a683-c11ca0b40f69%40googlegroups.com.
For more options, visit https://groups.google.com/groups/opt_out.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

0 comments:

Post a Comment