Re: [DIYbio] Sponsorship & Raising money for iGem

I would love if you could fix/update these issues/points that I've
found, then upload the new documents to a public URL so I can post
links to Facebook, etc...:



"The exhaust gas will pass through the reaction chamber and the SOx
and NOx in the gas stream will be reduced by the bacteria."
-- what exhaust gas??? you haven't mentioned.

"Our team planned to reduce the amount of the NOx and SOx gases
ejected through the exhaust vents."
-- what exhaust vents?


"positive zeta potential"
-- you should give a quick explanation of this, I am a scientist by
training and an engineer by day (software/electrical these days) but I
don't know that term... any rich business people that aren't
scientists/engineers will definitely not know what this is, and
probably won't be inclined to google the term.


what was your previous success, how about efficiency/completeness of
the gas cleanup?

what are SRCs?

"The genetically engineered bacteria will be immobilized onto
reactors, and will be used to reduce the pollution from diesel
generators."
-- only in slide 8 do you state what should be the second sentence of
the entire slide deck (and the main starting point of the PDF)

-- In the PDF you say:
'Working on the "Eco.coli" , we have managed to succesfully
synthesize the bacterial clone capable of reducing NOx and SOx into
NH3 and sulfur respectively. However, due to lack of time and funding,
we could not develop the table top model last year.'
-- but then in the powerpoint slides you mention that the Cysl gene
has not been cloned yet, and that in fact you only created the Nrfa
and Sqr clones and got them sequenced, it doesn't mention anything
about gas-stream remediation experiments. This is misleading, and
could cause some people to lose trust in your team or the project. Be
more clear about previous accomplishments, current status, and
roadmap/plan moving forward (should you get the $$$).


P.S. is this the gene system that normally functions in plant-root
ecosystems, and is generally anoxic (poisoned by oxygen)?

On Sat, May 30, 2015 at 10:35 AM, Ujjwal Thaakar
<ujjwalthaakar@gmail.com> wrote:
> Hi,
> My friends at IIT Delhi, India want to go to iGem. They won the bronze medal
> last year at iGem Jamboree 2014. Unfortunately they haven't found very many
> sponsors yet..
>
> They're aiming for the gold this time with a portable system that uses
> genetically modified bacteria to consume air pollutants and toxics, thus
> purifying the air. They need $16K. How do you guys suggest we raise this
> money. Can we as a community help them move forward by pooling in some
> money? If everyone on this mailing list even donates $4 then we'll meet the
> goal and help them go ahead.
>
> I'm attaching a PPT and the sponsorship prospectus if someone if interested.
>
> --
> -- You received this message because you are subscribed to the Google Groups
> DIYbio group. To post to this group, send email to diybio@googlegroups.com.
> To unsubscribe from this group, send email to
> diybio+unsubscribe@googlegroups.com. For more options, visit this group at
> https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---
> You received this message because you are subscribed to the Google Groups
> "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send an
> email to diybio+unsubscribe@googlegroups.com.
> To post to this group, send email to diybio@googlegroups.com.
> Visit this group at http://groups.google.com/group/diybio.
> To view this discussion on the web visit
> https://groups.google.com/d/msgid/diybio/CAJ1yqBaCwHGbzSL8XfM6ECpSQtkY7_UWWXrKYEgUrDTV0eXtsw%40mail.gmail.com.
> For more options, visit https://groups.google.com/d/optout.



--
-Nathan

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/CA%2B82U9%2BcUPh_7Oe5moqf6wWHTBfaphF622zqPikhD9Zmgnad-A%40mail.gmail.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

[DIYbio] Sponsorship & Raising money for iGem

Hi,
My friends at IIT Delhi, India want to go to iGem. They won the bronze medal last year at iGem Jamboree 2014. Unfortunately they haven't found very many sponsors yet..

They're aiming for the gold this time with a portable system that uses genetically modified bacteria to consume air pollutants and toxics, thus purifying the air. They need $16K. How do you guys suggest we raise this money. Can we as a community help them move forward by pooling in some money? If everyone on this mailing list even donates $4 then we'll meet the goal and help them go ahead.

I'm attaching a PPT and the sponsorship prospectus if someone if interested.

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/CAJ1yqBaCwHGbzSL8XfM6ECpSQtkY7_UWWXrKYEgUrDTV0eXtsw%40mail.gmail.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

Re: [DIYbio] Re: Will this sequence work as promotor?

Interesting info. Thanks a lot! Are known functioning modifications of LacI, LacZ, LacY? What if prducts of these genes would be LVA marked for faster degradation?

Am Samstag, 30. Mai 2015 17:42:34 UTC+3 schrieb Michael Tellier:
Interestingly, most Salmonella genomes have lost the lac operon, which seems to hinder its pathogenicity by down-regulating the genes involved in the flagelles. So if you put your construct in Salmonella, your gene will be always expressed since LacI is likely to be absent. You might need to add the LacI gene on your construct to express the repressor. 

About Salmonella and the absence of the lac operon:
http://link.springer.com/article/10.1007%2Fs00284-014-0720-7

On Saturday, 30 May 2015 15:02:00 UTC+1, Mega [Andreas Stuermer] wrote:
E coli and Salmonella are more or less related. So I guess the coli promoter woud likely work without modification. Does Salmonella have a lac repressor?

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/dee859d4-8360-4716-8cae-376e33fd9999%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

Re: [DIYbio] Re: Will this sequence work as promotor?

No. No one of Salmonella species has possibility to use lactose, so they don't have any parts of lactose operon. LacI should be inserted simultaneously with LacY and LacZ. Also, I've analysed Salmonella 16s rRNA sequencies on NCBI and there are differencies in RBS of E. coli and Salmonella(but yes, they are VERY similar). But, when I'll obtain "building blocks" with E.coli promoters and RBS I'll try to use them as well. And if I'll obtain not very good results - I'll try to use this.

Am Samstag, 30. Mai 2015 17:02:00 UTC+3 schrieb Mega [Andreas Stuermer]:
E coli and Salmonella are more or less related. So I guess the coli promoter woud likely work without modification. Does Salmonella have a lac repressor?

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/c3bea5ce-8842-46bf-b247-8506ff779d22%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

Re: [DIYbio] Re: Will this sequence work as promotor?

Interestingly, most Salmonella genomes have lost the lac operon, which seems to hinder its pathogenicity by down-regulating the genes involved in the flagelles. So if you put your construct in Salmonella, your gene will be always expressed since LacI is likely to be absent. You might need to add the LacI gene on your construct to express the repressor. 

About Salmonella and the absence of the lac operon:
http://link.springer.com/article/10.1007%2Fs00284-014-0720-7

On Saturday, 30 May 2015 15:02:00 UTC+1, Mega [Andreas Stuermer] wrote:
E coli and Salmonella are more or less related. So I guess the coli promoter woud likely work without modification. Does Salmonella have a lac repressor?

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/68c05f39-4ed8-46e3-8a8b-56a47e9dac3b%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

Re: [DIYbio] Re: Will this sequence work as promotor?

E coli and Salmonella are more or less related. So I guess the coli promoter woud likely work without modification. Does Salmonella have a lac repressor?

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/a174d00b-5fa5-4e2e-b83c-5b55d522e470%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

[DIYbio] Cultivation of bacteria

Hi everybody!
I wanted to learn the basics of DIY-Bio and so I started to cultivate bacteria that grow on my hand. After my 4th attempt there is still no result. I used gelatine and distilled water.

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/68bee99e-b28c-4762-b547-d5a531709f0d%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

Re: [DIYbio] Re: Will this sequence work as promotor?

Yes, it remains in exactly the same position relative to the operator. I think it is preferable to use Salmonella phage promotor for expression in Salmonella, doesn't it?

2015-05-30 14:01 GMT+03:00 Mega [Andreas Stuermer] <masterstorm123@gmail.com>:
 Extremely hard to say... I just know from T7 if you space lacO (or was it tetO) more than 5 bp away it doesn't work anymore because the DNA helix. The repressor will bind the operator but in a different angle... Have you made sure that the core promoter will be in the same position relative to the operator? Isn't it possible to take the native coli one?

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to a topic in the Google Groups "DIYbio" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/diybio/XA0TmSdYyL8/unsubscribe.
To unsubscribe from this group and all its topics, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/f0fb789d-c282-4d61-806a-e205285fe85c%40googlegroups.com.

For more options, visit https://groups.google.com/d/optout.

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/CAEcgnwEqJa_zC9LX7rngpb2CPyh5_tthM4%2BNgbAt6JrOJgzxDg%40mail.gmail.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

[DIYbio] Re: Will this sequence work as promotor?

 Extremely hard to say... I just know from T7 if you space lacO (or was it tetO) more than 5 bp away it doesn't work anymore because the DNA helix. The repressor will bind the operator but in a different angle... Have you made sure that the core promoter will be in the same position relative to the operator? Isn't it possible to take the native coli one?

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/f0fb789d-c282-4d61-806a-e205285fe85c%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

[DIYbio] Will this sequence work as promotor?

Sequence: ATTGTGAGCGGATAACAAAAACTTGACTAAAGATTCCTTTAGTAGATAATTGTGAGCGGATAACAATTC

It is based on p22 Salmonella phage promotor with replacement of OR1 and OR3 repressor binding sites by lactose operon repressor binding sites from Escherichia coli. How probable is what this construction will work?

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/31160580-6d1c-4c04-8a1e-46b69d32e245%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

[DIYbio] Re: Anyone in the Sacramento/Davis area interested in making a bio hackerspace?

I'm starting a PhD at UC Davis this fall, and yes, I'm definitely interested. I don't have a really clear idea of how to go about doing it, though.

> On Dec 21, 2011, at 10:49 PM, CodonAUG <elsbernd@gmail.com> wrote:
>
> Is there anyone in the Sacramento/Davis area interested in making a
> bio hackerspace (something akin to GenSpace or BioCurious).
>
> --
> You received this message because you are subscribed to the Google Groups "DIYbio" group.
> To post to this group, send email to diybio@googlegroups.com.
> To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
> For more options, visit this group at http://groups.google.com/group/diybio?hl=en.
>

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/B2D2DA1A-B716-413A-B3B7-A849DCA309BE%40trioptimum.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

Required || WebSphere Administrator || Dubuque, IA || 12+ Months || Phone And Skype || Only USC/GC

Dear Partner

Hope you are doing great!!

Please go through the requirement and let me know if you have any consultant for the same position.

 

Please do share me your hotlist also at Arpit@tresourceinc.com

 

WebSphere Administrator

Dubuque, IA

12+ Months

Phone And Skype

Only USC/GC

 

Required

 

Middleware Administration experience with WebSphere Application Server, BEA Weblogic Application Server, IBM HTTP Server/Apache, Sun Web Server, and/or WebSphere; support within operating systems and Web Middleware infrastructure environments; Middleware Administration experience within WebMethods, Tibco, BizTalk, Weblogic and/or Cyclone Band 5 - Server Systems Operations - Application Hosting Services - Web Middleware Enablement - WebSphere Application Server. Systems Management Specialist

 

Thanks and Regards,

Arpit Arora | Sr.Technical Recruiter

Technology Resource Group Inc. 
3736 Hillsdale Court Santa Clara, CA 95051

Office:408-709-1760 Ext : 961, Cell: 408-502-5132

Gtalk: Arpittechwire | Fax: 408-884-2409

Arpit@tresourceinc.com | www.tresourceinc.com

 

--
You received this message because you are subscribed to the Google Groups "VU Computer Science" group.
To unsubscribe from this group and stop receiving emails from it, send an email to vu-computer-science+unsubscribe@googlegroups.com.
To post to this group, send email to vu-computer-science@googlegroups.com.
Visit this group at http://groups.google.com/group/vu-computer-science.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

Required || .Net Developer || Lansing,MI || 12+ Months || USC / GC Only || Phone And Skype

Dear Partner

Hope you are doing great!!

Please go through the requirement and let me know if you have any consultant for the same position.

 

Please do share me your hotlist also at Arpit@tresourceinc.com

 

.Net Developer

Lansing, MI

12+ Months

USC / GC Only

Phone And Skype


Required

 

 Experience Required:

 

At least five years' experience with web development in ASP.Net and C#

 

At least five years' experience with web development in JavaScript

 

At least three years' experience with web development and an Oracle or SQL Server backend

 

At least six years' experience in object oriented programming

 

At least two years' experience with PL/SQL

 

At least three years of experience with Microsoft's MVC 4.0 or higher framework, including razor. Application Developer C#.NET

 

ASP.NET, C# 4.x, MVC Razor 5, HTML 5, CSS3, JQuery, JavaScript, Oracle and SQL Server database, object oriented development, PL/SQL, Test Driven Development, Unit Testing Familiarity With: JSON, Bootstrap, LINQPAD, Refactoring, MOQ, Design Patterns, Clean Code, Fiddler, IE Developer Tools, Fluent, Ninject, GRIDMVC

 

Thanks and Regards,

Arpit Arora | Sr.Technical Recruiter

Technology Resource Group Inc. 
3736 Hillsdale Court Santa Clara, CA 95051

Office:408-709-1760 Ext : 961, Cell: 408-502-5132

Gtalk: Arpittechwire | Fax: 408-884-2409

Arpit@tresourceinc.com | www.tresourceinc.com

 

--
You received this message because you are subscribed to the Google Groups "VU Computer Science" group.
To unsubscribe from this group and stop receiving emails from it, send an email to vu-computer-science+unsubscribe@googlegroups.com.
To post to this group, send email to vu-computer-science@googlegroups.com.
Visit this group at http://groups.google.com/group/vu-computer-science.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

Required || SSIS/ETL Developer || San Antonio, TX || 12+ Months || Phone And Skype || USC / GC

Dear Partner

Hope you are doing great!!

Please go through the requirement and let me know if you have any consultant for the same position.

 

Please do share me your hotlist also at Arpit@tresourceinc.com

 

SSIS/ETL Developer

San Antonio, TX

12 months Contract

US Citizen and Green Card holders

Client prefers local candidates.

 

 

Position Overview 

·         SSIS Developer with Extremely strong skills with ETL

·         They are in a Parallel data warehouse (Microsoft APS)

·         Nice to have:  PowerShell / python/ Hadoop/Apache

·         All Microsoft technologies

 

Thanks and Regards,

Arpit Arora | Sr.Technical Recruiter

Technology Resource Group Inc. 
3736 Hillsdale Court Santa Clara, CA 95051

Office:408-709-1760 Ext : 961, Cell: 408-502-5132

Gtalk: Arpittechwire | Fax: 408-884-2409

Arpit@tresourceinc.com | www.tresourceinc.com

 

--
You received this message because you are subscribed to the Google Groups "VU Computer Science" group.
To unsubscribe from this group and stop receiving emails from it, send an email to vu-computer-science+unsubscribe@googlegroups.com.
To post to this group, send email to vu-computer-science@googlegroups.com.
Visit this group at http://groups.google.com/group/vu-computer-science.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

[DIYbio] Re: Anyone in the Sacramento/Davis area interested in making a bio hackerspace?


http://www.meetup.com/BeniciaMakerspace/

Or Here is a Second Solution Lobby for Benicia Makerspace to conduct Biohacking DIY projects

On Wednesday, December 21, 2011 at 10:49:04 PM UTC-8, CodonAUG wrote:
Is there anyone in the Sacramento/Davis area interested in making a
bio hackerspace (something akin to GenSpace or BioCurious).

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/3280c213-b3a7-4f7e-ba8a-5ba6da6b164c%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

Required || Adobe CQ Admin || Charlotte, NC || 6+ Months || Phone And Skype

Dear Partner

Hope you are doing great!!

Please go through the requirement and let me know if you have any consultant for the same position.

Please do share me your hotlist also at Arpit@tresourceinc.com

 

Adobe CQ  Admin

Charlotte, NC

6+ Months

Phone And Skype

 

             5+ years' experience as Systems Admin

             Experience administrating Adobe CQ

             WebSphere experience

             Red hat enterprise Linux experience

             OS, Linux or DB2

o             Must have web infrastructure

o             Ecommerce experience

             They will be working on the infrastructure for Lowes.com, digital, and mobility.

             5+ years working in a AIX/Linux environment (AIX is IBM's version of Linux)

             5+ years' experience working with VMware

             5+ years working with WebSphere

 

Thanks and Regards,

Arpit Arora | Sr.Technical Recruiter

Technology Resource Group Inc. 
3736 Hillsdale Court Santa Clara, CA 95051

Office:408-709-1760 Ext : 961, Cell: 408-502-5132

Gtalk: Arpittechwire | Fax: 408-884-2409

Arpit@tresourceinc.com | www.tresourceinc.com

 

--
You received this message because you are subscribed to the Google Groups "VU Computer Science" group.
To unsubscribe from this group and stop receiving emails from it, send an email to vu-computer-science+unsubscribe@googlegroups.com.
To post to this group, send email to vu-computer-science@googlegroups.com.
Visit this group at http://groups.google.com/group/vu-computer-science.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

Required || Business Object/ BODeveloper || NYC,NY || 6+ Months|| GC/Citizen || Phone And F2F

Dear Partner

Hope you are doing great!!

Please go through the requirement and let me know if you have any consultant for the same position.

 

Please do share me your hotlist also at Arpit@tresourceinc.com

 

SQL Server Developer / SAP Business Objects BI Developer

NYC,NY

6+ Months

Phone And F2F

 

Candidates must be local and available for a F2F interview.

 

SQL Server Development skills – 70%.

BI Skills – 30%.

Must be a strong SQL Server Developer with strong experience with Business Objects Products.

 

Purpose of Position:

To design, develop, enhance and maintain reports in SAP BusinessObjects BI Platform and SQL Server database environment.

Key Responsibilities:

  • Interact with end users and business analysts to understand requirement.
  • Database object development in SQL Server environment
  • Report development in various SAP BusinessObjets BI Platform components, including Crystal Report, Universe, Web Intelligent and Dashboard
  • Source Code version control in Team Foundation Server.
  • Develop report documentation for deployment

 

Qualifications/Requirements:

·       Three years of experience in a health care related environment;

·       College degree in a related field;

·       Excellent MS SQL Server skills

·       Two years' experience with SAP BusinessObjects BI platform development

·       Knowledge of Visual Studio .Net Development

·       Ability to adapt to different projects and assignments;

·       Team player with strong analytical skills

 

Thanks and Regards,

Arpit Arora | Sr.Technical Recruiter

Technology Resource Group Inc. 
3736 Hillsdale Court Santa Clara, CA 95051

Office:408-709-1760 Ext : 961, Cell: 408-502-5132

Gtalk: Arpittechwire | Fax: 408-884-2409

Arpit@tresourceinc.com | www.tresourceinc.com

 

 

 

--
You received this message because you are subscribed to the Google Groups "VU Computer Science" group.
To unsubscribe from this group and stop receiving emails from it, send an email to vu-computer-science+unsubscribe@googlegroups.com.
To post to this group, send email to vu-computer-science@googlegroups.com.
Visit this group at http://groups.google.com/group/vu-computer-science.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

Urgent Client Need: InstallShield Consultant; Bedford, Mass; 7+ Months Contract

Please send your resumes at niranjan.kumar@vision3solutions.com

 

Hi,

 

This is Niranjan from Vision3solutions; hope you are doing well.

Please go through below description and reply with your resume, contact details and current location, if you feel comfortable

Title: InstallShield Consultant

Location: Bedford, Mass

Duration: 7+ Months Contract

 

Locals Only

Job Description

Project

Build the next generation enterprise Installer platform for TruCare from the ground up to automate the process of installing and configuring Tomcat 7 and Java EE Web applications in multi-server, clustered topologies. Automate the deployment and configuration of Java EE Web applications (WARs) on Tomcat servers, and the installation and configuration SQL Server databases for these applications. Additionally, build the necessary automation for upgrading JBoss 5.1.0 instances to Tomcat 7 in existing older-version installations of TruCare, migrating Java EE configurations from JBoss 5.1.0 to Tomcat 7, deploying updated Java EE Web applications (WARs) on the upgraded Tomcat instances, and executing the data migration and schema upgrade SQL scripts on SQL Server databases.

As part of a small, focused Scrum team, the InstallShield consultant will collaborate with the product manager and other build and install engineers to convert requirements and functional specifications into detailed technical designs, and implement those designs into a functional Installer solution.

·         Requirements

·         Advanced expertise with FlexeraInstallShield Professional or Premier (2012 or later).

·         2+ years' experience building enterprise-class Installer solutions for installing, deploying and configuring server-side applications and databases (Java or .NET) using InstallShield

·         Knowledge and experience with Subversion, Maven, Ant and Atlassian Bamboo.

·         Familiarity with the Java EE framework and Tomcat is desirable.

·         SQL knowledge preferred.

 

 

Thanks& Regards

 

Niranjan Kumar

cid:image001.jpg@01D0705F.83E60BC0

Vision3 Solutions Inc

8155 Cavendish Place,Suwanee, GA 30024
Contact No: 
(678) 554-4785
Email: niranjan.kumar@vision3solutions.com

                 niruk5503@gmail.com




--
You received this message because you are subscribed to the Google Groups "VU Computer Science" group.
To unsubscribe from this group and stop receiving emails from it, send an email to vu-computer-science+unsubscribe@googlegroups.com.
To post to this group, send email to vu-computer-science@googlegroups.com.
Visit this group at http://groups.google.com/group/vu-computer-science.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

Urgent Client Need: InstallShield Consultant; Bedford, Mass; 7+ Months Contract

Please send your resumes at niranjan.kumar@vision3solutions.com

 

Hi,

 

This is Niranjan from Vision3solutions; hope you are doing well.

Please go through below description and reply with your resume, contact details and current location, if you feel comfortable

Title: InstallShield Consultant

Location: Bedford, Mass

Duration: 7+ Months Contract

 

Locals Only

Job Description

Project

Build the next generation enterprise Installer platform for TruCare from the ground up to automate the process of installing and configuring Tomcat 7 and Java EE Web applications in multi-server, clustered topologies. Automate the deployment and configuration of Java EE Web applications (WARs) on Tomcat servers, and the installation and configuration SQL Server databases for these applications. Additionally, build the necessary automation for upgrading JBoss 5.1.0 instances to Tomcat 7 in existing older-version installations of TruCare, migrating Java EE configurations from JBoss 5.1.0 to Tomcat 7, deploying updated Java EE Web applications (WARs) on the upgraded Tomcat instances, and executing the data migration and schema upgrade SQL scripts on SQL Server databases.

As part of a small, focused Scrum team, the InstallShield consultant will collaborate with the product manager and other build and install engineers to convert requirements and functional specifications into detailed technical designs, and implement those designs into a functional Installer solution.

·         Requirements

·         Advanced expertise with FlexeraInstallShield Professional or Premier (2012 or later).

·         2+ years' experience building enterprise-class Installer solutions for installing, deploying and configuring server-side applications and databases (Java or .NET) using InstallShield

·         Knowledge and experience with Subversion, Maven, Ant and Atlassian Bamboo.

·         Familiarity with the Java EE framework and Tomcat is desirable.

·         SQL knowledge preferred.

 

 

Thanks& Regards

 

Niranjan Kumar

cid:image001.jpg@01D0705F.83E60BC0

Vision3 Solutions Inc

8155 Cavendish Place,Suwanee, GA 30024
Contact No: 
(678) 554-4785
Email: niranjan.kumar@vision3solutions.com

                 niruk5503@gmail.com

--
You received this message because you are subscribed to the Google Groups "VU Computer Science" group.
To unsubscribe from this group and stop receiving emails from it, send an email to vu-computer-science+unsubscribe@googlegroups.com.
To post to this group, send email to vu-computer-science@googlegroups.com.
Visit this group at http://groups.google.com/group/vu-computer-science.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

Re: [DIYbio] Re: Anyone in the Sacramento/Davis area interested in making a bio hackerspace?

Yes. Counter Culture Labs is only 20 minutes away from me. So much closer.

On May 27, 2015 12:59 PM, "Rikke Rasmussen" <rikke.c.rasmussen@gmail.com> wrote:

Marnia: if the trip to Oakland would be more manageable, Counter Culture Labs might be an option for you?

On Dec 23, 2011 12:30 PM, "Marnia Johnston" <marnia@gmail.com> wrote:
yeah, just as bad as the trek to Palo Alto or Sunnyvale.

On Thu, Dec 22, 2011 at 10:34 PM, CodonAUG <elsbernd@gmail.com> wrote:
I think you would hate that commute.

On Dec 22, 12:23 pm, Marnia Johnston <mar...@gmail.com> wrote:
> I'm in Concord but that might still be pretty far away.
>
>
>
>
>
>
>
> On Wed, Dec 21, 2011 at 10:49 PM, CodonAUG <elsbe...@gmail.com> wrote:
> > Is there anyone in the Sacramento/Davis area interested in making a
> > bio hackerspace (something akin to GenSpace or BioCurious).
>
> > --
> > You received this message because you are subscribed to the Google Groups
> > "DIYbio" group.
> > To post to this group, send email to diybio@googlegroups.com.
> > To unsubscribe from this group, send email to
> > diybio+unsubscribe@googlegroups.com.
> > For more options, visit this group at
> >http://groups.google.com/group/diybio?hl=en.

--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diybio@googlegroups.com.
To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
For more options, visit this group at http://groups.google.com/group/diybio?hl=en.


--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diybio@googlegroups.com.
To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
For more options, visit this group at http://groups.google.com/group/diybio?hl=en.

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/CALZhpzLfRxprWYwe7%3DDFTJ%2B6J%3DkFGARG88bxi6q46-itWwe__g%40mail.gmail.com.
For more options, visit https://groups.google.com/d/optout.

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/CAGuzomLPvBFRh1ri0irjWdx%2Bfq4dcwgx0C-hoUVYtb4-sDxsJA%40mail.gmail.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS