Hi guys,
I'm gonna get Primers for bacterial Kanamycin resistance very soon. My long primers are on ice for a few weeks...
Just wanted to post my design, in case anyone would also need Kanamycin primers one day:
Foward (RBS included):
5' ATAtctagaGaattcggGAggGAGGCatgATTGAACAAgAT 3' yellow marked is SalI restriction site, red another as kind of a backup. The blue code is the unchanged 5' ladder, behind that (around -8) I changed the code into a SD-sequence.
Backward:
3' AGAACTGCTCAAGAAGACTCCTAGGATATATAT 5' yellow = BamHI
The Kanamycin resistance I'll get from pGreenII (changed the RBS of plant selection gene nptII that has no introns because of bacterial origin):
http://www.ncbi.nlm.nih.gov/nuccore/EU048864.1
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio?hl=en.
To view this discussion on the web visit https://groups.google.com/d/msg/diybio/-/JMQfGLbqVNMJ.
For more options, visit https://groups.google.com/groups/opt_out.
0 comments:
Post a Comment