[DIYbio] Re: Transgenic CCD resistant honeybee - need help

Hi everyone,  

The DNA construct is synthesized and will be subcloned. Now I am desinging a version 2.0 (right, before v1 was tested. But I have the uppermost confidence it is going to work). My beekeeper in the US will do the actual transfection, so I am freed up to do some work on v2.

However, now I will need the "good old" CMV promoter. Does anyone know whether I can use it without it's enhancer? Will it still have the same expression pattern as the full lentgh promoter (probably not, that's why I am asking)? 

CMV enhancer
GTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATG

CMV minimal promoter
GTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT


Usually it is nice to just take the full-lentgh promoter, knowing it will work as in the literature. But obviously, paying 200 bp more synthesis instead of 500 bp more (if it is unneccessary) makes a difference :D  
I need to be sure about this, because I'd rather pay more if unsure if it would work. 



--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/ab268126-0747-44d1-a748-623c96c25324%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

0 comments:

Post a Comment