[DIYbio] Re: Multiplexed crispr genome editing

Hi Mega

Have you tried your sugested implementation of spacers between the ribozymes? 

Thanks. 

Den torsdag den 21. maj 2015 kl. 21.09.43 UTC+2 skrev Mega [Andreas Stuermer]:
Hi everyone,

Just came across something awesome I wanted to share.
Hammerhead ribozymes were actually successfully tried to produce multiple crispr-guide RNAs (the problem with normal mRNAs is that they are exported from the nucleus into the cytosol, but the crispr/cas9 enzyme and the DNA are in the nucleus).

Here's one paper
"Self‐processing of ribozyme‐flanked RNAs into guide RNAs in vitro and in vivo for  CRISPR‐mediated genome editing", from which I take the graphic.

Here one example how it was done:

Promoter (CMV)
tagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctggtttatgaaccgtcagatcc

UTR/RE
gagctc

homolgy site
cgacta


5' Hammerhead Ribozyme (cuts at it's 3' end)
ctgatgagtccgtgaggacgaaacgagtaagctcgtc

targeting gene sequence
tagtcgcgtgtagcgaagca

gRNA scaffold
gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc

whatever (important spacer?)
tttt

3' HDV ribozyme (cuts at the 5' of the ribozyme)
ggccggcatggtcccagcctcctcgctggcgccggctgggcaacatgcttcggcatggcgaatgggac


UTR (from cloning)
cccgggatgctagctaa

polyA
gcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccctagggggaggctaactgaaacacggaaggagacaataccggaaggaacccgcgctatgacggcaataaaaagacagaataaaacgcacggtgttgggtcgtttgttcataaacgcggggttcggtcccagggctggcactctgtcgataccccaccgagacgccattggggccaatacgcccgcgtttcttccttttccccaccccaccccccaagttcgggtgaaggcccagggctcgcagccaacgtcggggcggcaggccctgccatagcctcag


It will be probably a pain for synthesis companies to synthesize, but can save you a lot of (sub)cloning pain and costs are probably similar to getting PCR reagents and primers and stuff. If PCR doesn't even cost more.

You can thus add multiple gRNAs in one big RNA, from one promoter. Like

Promoter--(HH)-gRNA1-(HDV) --spacer--(HH)-gRNA1-(HDV) --spacer--(HH)-gRNA1-(HDV) --spacer--(HH)-gRNA1-(HDV) --spacer-- polyA

Good spacers would probably be like this
ATACTATCAATACTTATCCATCATA
ATTACTTAACCATAATATCTTAACCAT

High in AT - so no interference with ribozymes. Some Cs in it,synthesis companies have local GC content lower limits


--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diybio@googlegroups.com. To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+unsubscribe@googlegroups.com.
To post to this group, send email to diybio@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/4dc70022-efeb-4bed-a6f6-6ff908ea2876%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

0 comments:

Post a Comment