Re: [DIYbio] BLAST query analysis

biopython does blast easily... its pretty well documented too

Are you blasting against local genome data or using web... e.g. NCBI?

On Wed, Mar 14, 2012 at 2:55 PM, Jeswin <phillyj101@gmail.com> wrote:
> Hi all,
> To prepare probes and primers, I have to use BLAST to determine the
> best choices for the sequence of interest. I need to find the number
> of each dissimilar sequence to my query. The result is in the format:
>
> Query     1     AACGGCCAGGTCTGTGCCAAGTGTTTGCTGACGCAACCCCCACTGGCTGGGGCTTGGTCA  60
> U95551    1162
> ............................................................  1221
> AJ627221  1160
> ............................................................  1219
>
> I need to know how many of each type there is compared to my query.
> The above is just an example. The way the boss analyzes is by copying
> to MS Word, removing the sequence identifiers (e.g. U95551) and the
> numbers. Then he puts it into Excel and sorts it out. Then he
> determines how many of each hit there is. In the end, he has a list of
> each of the hits and their frequency.
>
> I'm looking for a faster way than his approach. I am looking at the
> BIOPerl modules to see if anything matches. Is there something already
> available for this purpose?
>
> Thanks
>
> --
> You received this message because you are subscribed to the Google Groups "DIYbio" group.
> To post to this group, send email to diybio@googlegroups.com.
> To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
> For more options, visit this group at http://groups.google.com/group/diybio?hl=en.
>

--
Nathan McCorkle
Rochester Institute of Technology
College of Science, Biotechnology/Bioinformatics

--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diybio@googlegroups.com.
To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.
For more options, visit this group at http://groups.google.com/group/diybio?hl=en.

  • Digg
  • Del.icio.us
  • StumbleUpon
  • Reddit
  • RSS

0 comments:

Post a Comment